Prevalence and characteristics of Escherichia coil serotype O157:H7 and other verotoxin-producing E. coli in healthy cattle

7 pages
41 views
of 7
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
Prevalence and characteristics of Escherichia coil serotype O157:H7 and other verotoxin-producing E. coli in healthy cattle
Tags
Transcript
  Epidemiol. Infect.  1996), 117, 251-257 Copyright © 1996 Cambridge University Press Prevalence and characteristics of Escherichia coli serotype 0157: H7 and other verotoxin-producing E. coli in healthy cattle M. BLANCO1, J. E. BLANCO1, J. BLANCO *, E. A. GONZALEZ1, A. MORA1, C. PRADO1, L. FERNANDEZ1, M. RIO1, J. RAMOS AND M. P. ALONSO3  Departamento de Microbiologia y Parasitologia and2Departamento dePatologia Animal,Facultad de Veterinaria, Universidad de Santiago de Compostela, 27002 Lugo 3Unidad de Microbiologia, HospitalXeral-Calde, 27004Lugo, Spain  Accepted 2 April 1996) SUMMARY From February to July of 1994, 328 faecal samples from 32herds were collected and verotoxin-producing Escherichia coli  VTEC) foundon 84 of the farms. The proportion of animals infected varied from 0-63  . VTEC were recovered from 52  20  ) of257 cowsand from 16 23  ) o 71 calves. Although the VTEC belonged to 25 different serogroups, 7  08, 020, 022,077, 0113, 0126 and0162) accounted for 46 of strains. Nearly 45   of the 83 bovine VTEC strains belonged to serogroups associated with haemorrhagic colitis and haemolytic uraemic syndrome in humans. However, only2  2  ) of 83 VTEC strains isolated from cattle belonged to enterohaemorrhagic E. coli  EHEC) serotypes  026: H 11 and 0157:H7), and only 8  10 ) were positive for theattaching and effacingE. coli  eae) gene sequence. Polymerase chain reaction  PCR) showed that17  20 ) of VTEC strains carried VT1 genes, 43  52  ) possessed VT2 genes, and 23  28  ) carried both VT1 and VT2 genes. Characterization of VTEC isolates revelated a heterogeneouspopulation in termsof serogroup and toxin type in thepositive herds. Thisstudy confirms that healthy cattle are a reservoir of VTEC, but, the absence of eae g n s in mostbovine VTEC strains suggests that they may be less virulentfor humans than eae-positive EHEC. INTRODUCTION Verotoxin-producing Escherichia coli  VTEC) are recognized as a cause of haemorrhagic colitis  HC) and the haemolytic-uraemic syndrome HUS), in humans who contract infection following the con- sumption of contaminated foodstuffs like meat and unpasteurized milk [1-4]. Epidemiological investi- gations revealed that cattle frequently excrete VTEC in their faeces and thus may represent asource of infection[5-10]. However, the epidemiology of the organism remains unclear. Identification of the source of contamination of foodswith VTEC is important to the understanding of the epidemiology of human VTEC infection and devising strategiesfor its control. To date most surveys of bovine VTEC infection have expressed the prevalence of infection as the proportion of infected animals in the population. Equally im- portant, from a public health standpoint, is the determinationof farm-level prevalence of infection, an aspect of the epidemiology of VTEC which has so far received little attention [11- 13]. VTEC from different sources and geographical areas belong to many different 0 serogroups. How- ever, mostof the documented outbreaks of HC and HUS were attributed to only a few serotypes  e.g. 026:H1, 0111 :H- and 0157:H7 or H-) which havebeen designated enterohemorrhagic E. coli  EHEC)  252 M. Blanco and others [1-4, 14]. It is not known whether all variants of VTEC are equally pathogenic for humans.However, the relatively low incidence of non-EHEC VTEC disease in humans suggest that VT production alone may notbe sufficient for VTEC to cause disease [15, 16]. A factor that may affect virulence of VTEC is the ability to cause attaching and effacing lesions in the intestinal mucosa [15-17]. In this study the prevalence of VTEC infection incattle in the province of Lugo  Galicia, Northwest Spain) was investigated at the herd and individual animal levels. MATERIALS AND METHODS Specimens collection and E. coli strains Thirty-two farms in the province of Lugo  Galicia, Northwest Spain) were visited once betweenFebruary and July of 1994. Both beef and dairy cattle were sampled. A singlefaecal swab was obtained from selected cows and from all calves aged 4 months or less. The swabs were placed in transport medium and taken to laboratory for immediate processing. They were used to inoculate lactose-MacConkey agar and cefixime tellurite sorbitol MacConkey CT-SMAC medium [7]. From each sample five suspect E. coli colonies lactose positive,lactose negative or sorbitol negative) were chosen, identified and examined for verotoxin  VT production. Identification wasbased on biochemical tests including hydrogen sulphide, citrate, urease and indole. All VTEC strains were confirmed as E. coli using the API-20E system  bioMerieux, France). Reference E.coli strains used as positive and negative controls, included: 933  0157:H7 VT1+, VT2+ and eae+), H19  026:Hll, VT1+ and eae+) and K12-185  non-toxigenic). Strains were stored at room temperature in nutrient broth with 0-75   of agar. Production and detection of verotoxins in Vero and HeLa cells Forproduction of verotoxins, bacteria were grown for 20 h in Tryptone Soya Broth with mitomicin C  t 37 °C  shaken at 200 rpm and then centrifuged  6000 g) for 30 min at 4  C. The Vero and HeLa cell cultureassays were performed usingnearly confluent cell monolayersgrown in plates with24 wells. At the polymixin sulphate) was changed  0 5 ml per well) and 75  ul undiluted culture supernatant added. Cells were incubated  t 37 °C in a 5   CO2 atmosphere and the morphologicalchanges in cells observed after 24 and 48 h of incubation using a phase contrast inverted microscope [18]. Detection o VT1, VT2 and eaesequences by PCR Bacteria were harvested from CFA agar suspended in 200  ul of sterile water, incubated at 100 °C for 1 min to release the DNA and centrifuged. The supernatant was used in the PCR reaction as described below. Base sequences locations and predicted sizes of amplified products for the specific oligonucleotide primersused in this study are shown in Table 1 [19,20]. Oligo-nucleotide primers were synthesized using a Gene Assembler Special  Pharmacia, LKB Biotechnology Inc.) according to the manufacturers instructions. Amplificationof bacterial DNA w s performed using50 jtl volumes containing 10  1 of the preparedsample supernatant; the oligonucleotide primers  90 ng for eae and VT2 primers; 150 ng for VT1 primers); 0-2 mm  each) dATP, dGTP, dCTP, and dTTP; 1 mm Tris HCI  pH 8 8); 1,5 mm MgCl2; 50   KCI; and 1 U of DynaZyme DNA polymerase  Finnzymes OY Finland). The reaction mixtures were overlaid with an equal volume ofmineral oil. The conditions for the PCR were 94 °C for 2 min for initial denaturation of DNA within the sample followed by 30 cycles of94 °C for 1 min  denaturation), 55 °C for 1 min  primer annealing) and 72 °C for 1 min  DNA synthesis) performed with a thermal cycler  model Gene ATAQ Controller; Pharmacia, LKB Biotechnology Inc, Sweden . The amplified product was visualized by standard submarine gel electrophoresis using 10  ul of the final reaction mixture o a 2   agarose  agarose MP Boehringer Mannheim,Germany gels in TBE buffer  89 mm Tris, 89 mm boric acid, 2-5 mm EDTA . The samples were electrophoresed for 40 min at 140 V. Amplified DNA fragments of specific sizes were located by UV fluorescence after staining with ethidium bromide  0S5 ,ug/ml). Molecular size markers  Hae III digest of Ox174DNA were included in each gel. Serotyping The isolates were serotypedusing a modification [21] of the method of Guinee and colleagues [22].   time of assay, the growth medium  RPMI with  01-0171) and H  HI-H56) antisera were absorbed  Verotoxin-producing E. coli from healthy cattle 253 Table 1 for VTJ, Primersused in PCR to amplify specific fragments from genes VT2 and eae Size of Oligonucleotide Location amplified Primer* sequence (5 -3 ) within genetproduct (bp) VTla C GTT TGTGGTGGCG G 215-234 894 VTlb CTGCTAATAGTTCTGCGCATC 1089-1109 VT2a CTTCGGTATCCTATTCCCGG 288-307 478 VT2b GGATGCATCTCTGGTCATTG 747-766 eae-   ACGTTGCAGCATGGGTAACTC 1054-1074815 eae-2 GATCGGCAACAGTTTCACCTG 1869-1849 * References: VT1 and VT2 (20) and eae (19). t In nucleotides. Table 2 Prevalence of VTEC strains in healthy cattle Number ofanimals with VTEC strains Age Number of group animals Total VT1+ VT2+ VT1+VT2+ eae+ Cows 257 52  20 ) 7  3 ) 33  13 ) 16  6 ) 2  1 ) Calves 71 16  23 ) 7  10 ) 6  8 ) 4  6 ) 5  7 ) with the corresponding cross-reacting antigens to remove thenon-specific agglutinins. The antisera were obtained from the National Institute of Public Health and Environmental Protection (Bilthoven, The Netherlands). The 0 antigen was established in all VTEC detected, whereas the flagellar antigen was determined in VTEC belonging to serogroups 026, 0111and 0157.belonged to 25 different serogroups; however, 46 (38 of 83) were among 7 serogroups (08, 020,022, 077,0113,0126, 0162) (Table 4 In 16  24 ) animals with VTEC, 2 (14 animals) or 3 (2 animals) serogroups were identified. In many farms a variety of VTEC strains with different 0 serogroups were detected (Table 3 Only two VTEC strains,isolated from calves, belonged to EHEC serotypes  026: HI and0157:H7). Statistical methods Results were evaluated using the x2 test with Yates correction for continuity. RESULTS Prevalence of VTEC in healthy cattle A total of 1469 E. coli colonies from 328 animals from 32 different farms were investigated for verotoxin production in Vero and HeLa cells VTEC were recovered from 52  20 ) of 257 cows and from 16(23  ) of 71 calves (Table 2) from 27  84 ) of 32 farmsexamined. The estimated proportion of animals infected on each farmrangedfrom 0-63   (Table 3 Serogroups and EHEC serotypes   total of 83 VTEC strains were identified in this study, 60 from cows and 23 from calves. VTEC strains Verotoxins  VT1 and VT2) synthesized by VTEC strains and attaching and effacing E. coli (eae) sequences PCR demonstrated that 17  20 ) of VTEC strains carried VT1 genes, 43 (52  ) possessed VT2 genes, and 23 (28  ) carried both VT1 and VT2 genes (Table 4 VT1+ strains were more prevalent in VTEC obtained from calves than from cows (39   vs. 13  )  P < 0-05), whereas VT2+ strains were more com- monly recovered from cows (58   vs. 35  ). In contrast, similar proportions of VT1+VT2+ strains were observed in adult (28  ) and young (26  ) animals (Table 5 Only 8  10 ) of the 83 VTEC strains were positive for eae genes. Presence of eae genewas significantly more frequent among VTEC strains isolated from calves  26 ) than from cows (3  ) P <0-01).  254 M. Blanco and others Table 3. Distribution of VTEC strains in the 32 farms investigated Number VTEC+/ Number of animals examined Farm Cows Calves Serogroups of VTEC 1 1/7 0/2 NT I t 2 2/5 0/5 08  1 , NT  2 3 1/81/2 077  1 , 0171  1 4 2/10   0113  1 , NT  1 5 0/4 2/5 022  1 , 088  1 6 0/80/2 7 5/8   08  1 , 022  1 , 077  1 , NT  2 8 2 7 0/2 04  1 , 0113  1 9 3/7 0/1 02  1 , 020  2 10 2/8 0/1 0116  1 , 0162  1 ,   1 11  8 1/2 0138  1 , NT  2 12 1/8 0/2 0113  1 13 2/60/4 077  1 , 0113  1 , NT  1 14 0/4 0/1 15 2/10 0/1 08  1 , 096  1 16 3/10   0113  3 , NT  1 17 3/9 0/1 0138  1 , 0140  1 , 0168  1 ,   2 18 2/8 0/2 022  1 , NT  1 19 1/91/3 015  1 , 020  1 , 0149  1 ,   1 202/6 1/4 07  1 , 077  1 , NT  1 21 1/7 1/3 022  1 , 026  1 222/9 1/2 08  1 , 081  1 , NT  3 23 1/6 3/6 020  1 , 077  1 , 0116  1 , 0126  3 , NT  1 243/8 0/2 077  2 , 0162  1 25 3/10 022  2 , 0136  1 26 1/6 1/1 077  1 , 0113  1 270/8 0/2 28 0/8   29 1/15 0/5 0136  1 30 0/50/5 31 1/5 4/5 09  1 , 015  1 , 0157  1 , NT  2 32 4/20 020  1 , 0110  1 , 0162  1 , NT  1 * Not typeable strains.t Number ofanimals yielding VTEC strains belonging to indicated serogroups. DISCUSSION The results of this study indicate that VTEC infection is widespread among healthy cattle in the province of Lugo. VTEC strains were present in similar propor- tions in adult and young animals  20   s. 23  ). In contrast, to some previous studies, in which VTEC were more frequently recovered from young dairy cattle [9, 12, 13]. In a study, comparable in many respects to this one, Wilson and co-workers [12] estimated the prevalence of VTEC infection in cows and calves on Ontario  Canada) dairy farms at 9   and 25   espectively. While, Wells and colleagues [9] in the USA found VTEC in8   f adult cows and 19 of heifers and calves, and Montenegro and co- workers [11] in Germany identified VTEC in 17 of cows and 9   of bulls. PCR demonstrated that 20 of bovine VTEC strains isolated inthis study carried VT1 genes, 52 possessed VT2 genes, and 28   carried both VT1 and VT2 genes. Severalother authors have reported a similar distribution in VTEC from healthy cattle [6, 9, 10, 11]. In contrast, Pohl [23], Wieler [24], Dorn and colleagues [25] observed that the majority of VTEC isolated from calves withdiarrhoea in Belgium, Germany and USA produced VT1 only while in previous studies [5, 26, 27] we found that 72   were VT1+, 23   were VT2+ and 5   were VT1+VT2+  data  Verotoxin-producing E. coli from healthy cattle 255 Table 4 Serogroups, type of VT and eae gene in VTEC strains recovered from healthy cattle Number of VTEC strains Serogroup Total VT1+ VT2+ VT1+VT2+ eae+ 02 1  1/0/1 *0 1 0 0 04 1  1/0/1 0   0 0 07 1  0/1/1 0 0 0 08 4  3/1/4 0 4 0 0 09 1  0/1/1 0 1 00 015 2  2/0/2 0   0 020 5  4/1/4 0 1 4 0 022 6  5/1/5 0 4 2 0 026 1  0/1/1 0 0   077 8  6/2/7 1 2 5 1 081   1/0/1 00   0 088 1  0/1/1 0   0 0 096 1  1/0/1 00   0 0110   1/0/1 0   0 1 0113 8  8/0/6 7 0 0 0116 2  1/1/2 0 2 0 0 0126 4  1/2/1 0 3 0 0136 2  2/0/2 2000 0138 2  1/1/2 2 00   0140 1  1/0/1 0   00 0149 1  0/1/1 000 0157 1  0/1/1 0 1 0 1 0162 3  3/0/3 0 2 1 0 0168 1  1/0/1 0 00 0171 1  0/1/1 0 1 0 0 NTt 23  16/6/16 6 12 53 Total 83  52/16/27) 17  20 ) 43  52 ) 23  28 ) 8  10 ) * Number of cows, calves and farms yielding VTEC strains belonging to indicated serogroups. t Not typeable strains. Table 5 Typeof VT, eae gene and EHEC in bovine VTEC strains Number of VTEC strains from Characteristics of Cows Calves VTEC strains  n   60 n = 23 VT1+ 8  13 ) 9  39 ) VT2+ 35  58   8  35 )VT1+VT2+ 17  28 ) 6  26 ) eae+ 2  3 ) 6  26 ) EHEC* 0  0  ) 2  9 ) * Enterohaemorrhagic E. coli serotypes were recovered in two cases: one strain 026:H11 VT1+eae+ and one strain 0157:H7 VT2+eae+. not shown). Little is known about the putative pathogenic role of VTEC in cattle. Although VTEC strains have been isolated from a high proportion of both healthy and diarrhoeic calves [5-13, 23-28], recent studies suggestthat strains that produce VT1 only, and possess the eae gene, in addition may be involved in calf diarrhoea [24, 25, 29]. Interestingly we found the eae genes significantly more frequently in VTEC isolated from diarrhoeic calves  59  )  23 of 39 than in those from healthy cattle  10 )  P < 00001 . Dornand co-workers [25] suggeststhat the higher prevalence of VT2-producing E. coli than VTl E. coli infections among adult cattle might result in a greater passive transfer of antibodies to VT2 than VT 1 resulting in lower incidenceof clinicalillness due to VT2-producing VTEC strains in calves. This interesting hypothesis requires further investigations. The production of VT by E. coli strains of bovine srcin has been detected in 79 0 serogroups, although 20  04, 08, 022,025,032,045, 082,084,0103, 0111, 0113, 0116, 0121,0136,0146,0153, 0157,
Related Search
Similar documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks